Lone Gunman

An old (but still cur­rent) news story from India never gained much atten­tion out­side of the coun­try, but seems worth sharing.

For over thirty years, cor­rup­tion and bribery have allowed peo­ple to declare oth­ers ‘dead’ — with­out for­mal evi­dence — thus allow­ing the claimant to take own­er­ship of the deceased’s farm­ing land. The newly ‘dead’ will usu­ally know noth­ing of their pass­ing until they have some for­mal inter­ac­tion with a gov­ern­ment ser­vice, where they will be told that they are dead and are there­fore not enti­tled to the service.

One such vic­tim, who was offi­cially dead for 18 years, formed The Asso­ci­a­tion of the Dead to raise aware­ness of the issue: “The Asso­ci­a­tion seeks to reverse the dec­la­ra­tions, call atten­tion to the prob­lem and pre­vent oth­ers from being exploited in sim­i­lar fash­ion.”

When was the last time you had to check if you were dead?

The speed at which Syn­thetic Biol­ogy is evolv­ing (pun intended) is mind-blowing, espe­cially to some­one who has just stum­bled upon the sci­ence (inspired by Tuur Van Balen’s pre­sen­ta­tion at Inter­est­ing 2009). In his words, it “will make most of us won­der why we ever got so excited about the Inter­net”.

You can tell a tech­nol­ogy has excit­ing poten­tial when ridicu­lous neol­o­gisms spread as quickly as the tech­nol­ogy itself. In the 1990s the Inter­net had peo­ple “surf­ing” “cyber­space”; now syn­thetic biol­ogy has biop­unks and wet­ware hack­ers.

Although much of the cur­rent lit­er­a­ture is beyond my rudi­men­tary under­stand­ing, the idea of Bio­Bricks seems incred­i­ble. I would describe it as a “genetic pro­gram­ming lan­guage”, but that doesn’t do it jus­tice. To para­phrase the descrip­tion on the website:

Using Bio­Brick™ … parts, [you] can … pro­gram liv­ing organ­isms in the same way a com­puter sci­en­tist can pro­gram a com­puter. The DNA sequence infor­ma­tion and other char­ac­ter­is­tics of Bio­Brick™ stan­dard bio­log­i­cal parts are made avail­able to the pub­lic free of charge cur­rently via MIT’s Reg­istry of Stan­dard Bio­log­i­cal Parts.

In other words, there’s a grow­ing free data­base of ‘bio­log­i­cal parts’ (tastes, smells, reac­tions, pro­teins) that you can piece together to ‘re-program’ exist­ing bio­log­i­cal sys­tems (typ­i­cally bac­te­ria); for exam­ple, here’s a part for a Banana odour gen­er­a­tor:

tcc­c­tatcagt­gata­ga­gattga­catc­c­c­tatcagt­gata­ga­gat­act­gag­cac­tac­ta­ga­gat­taaa­gag­ga­gaaat­ac­ta­gat­gaat­gaaatc­gatga
gaaaaatcaggc­c­c­c­cgt­g­caa­caa­gaat­gc­ct­gaaa­ga­gat­gattca­gaatgggcat­gctcg­gcg­tatgggatct­gttgaa­gatct­g­tat­gttgctctc
aaca­ga­caaaact­tatatc­gaaacttct­g­ca­catatg­ga­gaattgagt­gat­tact­g­tac­tagggatcagct­ca­cattagctttgagggaaatct­gc­ctga
aaaatc­caactcttt­ta­catattgttc­tac­caa­caa­gatg­gc­caaat­cat­gaaaat­tat­tatcgcagttc­c­gaat­ac­tattcacg­gc­ca­catccagt­gca
tgat­tatatttcagtat­ta­caa­gaattgaaact­gagtg­gt­gtg­gttct­caat­gaa­caac­ct­gag­tacagt­gcagtaat­gaag­caaatatta­gaa­gagttc
aaaaatag­taagggttc­c­tat­act­g­caaaaatttt­taaact­tac­tac­cactttgac­tattc­ct­tactttg­gac­caacaggac­c­gagttg­gcg­gc­taattt
gtcttcca­gaa­gag­ca­caca­gaaaagtg­gaaaaaatt­tatctttg­tatc­taat­cattg­cat­gtct­gatg­gtcg­gtcttc­gatc­cacttttttcat­gattt
aaga­gac­gaat­taaataatat­taaaactc­cac­caaaaaaatta­gat­ta­cattttcaag­tac­gag­gag­gat­tac­caat­tattgag­gaaacttcca­gaaccg
atc­gaaaag­gt­gata­gactt­ta­gac­cac­cg­tacttgtt­tattc­c­gaagt­cacttctttcgggtttcatc­ta­caat­catttga­gattttcttcaaaag­gtg
tct­g­tat­ga­gaatg­gat­gat­gtg­gaaaaaac­c­gat­gat­gttgt­cac­c­ga­gat­cat­caatatttcac­caaca­gaatttcaagc­gat­taaag­caaatat­taa
atcaaatatc­caag­gtaagt­g­tac­tat­cactc­cgtttt­ta­cat­gtttgttg­gtttg­tatctcttcataaatggggtaaatttttcaaac­cattgaacttc
gaatg­gct­tacg­gatatttt­tatc­c­c­cgca­gattgc­cgct­ca­caac­tacca­gat­gat­gat­gaaat­ga­gaca­gat­g­taca­gatatg­gcgc­taacgttg­gat
ttattgacttcac­c­c­c­ctg­gataagc­gaatct­ga­cat­gaat­gataa­caaa­gaaaatttttg­gc­cact­tattgag­cac­tac­cat­gaag­taatttcg­gaagc
tttaa­gaaataaaaag­catctc­catg­gct­tagggttcaatat­a­caag­gcttcgttcaaaaatat­gt­gaa­cattga­caag­gtaat­gt­gc­gatcgt­gc­catc
gggaaaa­gacgcg­gag­gta­cattgt­taag­caat­g­tag­gtct­gtt­taatcagt­ta­gag­gagc­c­c­gat­gc­caaatattc­tatat­gc­gatttg­gcatttg­gcc
aatttcaag­gatc­ctg­gcac­caag­cattttc­cttgggt­gtttgttc­gac­taat­g­taaaggggat­gaatattgttgttgcttcaa­caaa­gaat­gttgttgg
tagt­caa­gaatctctc­gaa­gagctttgctc­catt­ta­caaagctctc­cttt­tag­gc­c­ct­taataat­ac­ta­gagccaggcat­caaataaaac­gaaag­gctca
gtc­gaaa­gactgggc­ctttcgttt­tatct­gttgtttgtcg­gt­gaacgctctc­tac­ta­gagt­ca­cactg­gct­cac­cttcgggtgggc­ctttct­gcgtt­tat
a

At the moment, this isn’t quite avail­able to the pub­lic; “re-programming” the bac­te­ria cur­rently requires a range of equip­ment, from the sim­ple Petri dish to a cen­trifuge and incubator.

Even still, I’m excited by the prospect that this tech­nol­ogy could become acces­si­ble to non-academics in the next ten years. In my crazed sci-fi mind, I pic­ture an ‘off the shelf’ bacteria-pre-loaded ‘petri dish’ that you can ‘load into’ a com­po­nent in your home PC; the CD-like device can then act as a cen­trifuge and any­thing else that’s required of it (the words of an igno­rant dreamer!).

You can read more about Bio­Bricks on Wikipedia, and numer­ous O’Reilly Radar posts (here, here, here and here) – all highly rec­om­mended reading.

Let’s assume that if you had a few mil­lion pounds, you could prob­a­bly buy your­self some hit songs from a song­writer, some stu­dio and musi­cian time, plenty of mar­ket­ing, and almost cer­tainly get your­self a pop career.

The ques­tion is; is it eas­ier to get your­self into this posi­tion (a mil­lion­aire pop star) via pure luck (by enter­ing the lot­tery) or by enter­ing a com­pe­ti­tion like the X-Factor?

We don’t know how many peo­ple apply for the X-Factor, but based on 10,000 peo­ple at a sin­gle Lon­don audi­tion, we could con­ser­v­a­tively esti­mate 40,000.

Although the X-Factor mar­kets itself on the win­ner receiv­ing a “£1 mil­lion record­ing deal”, recent infor­ma­tion about the con­tract has sur­faced that shows “the vic­tor may only receive £1 mil­lion after at least four albums” (note the ‘may’ and ‘at least’; we’ll ignore these for now and assume they will after four albums).

If we look at the num­ber of albums released by win­ners of this type of show (X-Factor, Pop­stars, Pop Idol), we find that less than one in five win­ners (to date) have released four or more albums.

And we can’t even expect this to improve; plot­ting all the chart posi­tions (for sin­gles and albums) for all of these win­ners, over time, shows a dis­tinct down­ward trend:

So, 1 in 40,000 appli­ca­tion odds com­bined with 1 in 5.5 “four albums” odds gives total odds – of enter­ing the X-Factor, win­ning and becom­ing a mil­lion­aire because of it – of about 1 in 220,000.

The chances of win­ning the lot­tery (with aver­age jack­pot win­nings of £2,053,984) is 1 in 13,983,816. You would there­fore need to buy £64 of tick­ets for a slightly bet­ter chance of win­ning the jack­pot than becom­ing a mil­lion­aire through win­ning the X-Factor. £64 may seem like a lot, but prob­a­bly doesn’t com­pare to the cost of trav­el­ling to/from the audi­tions, tak­ing a day off work to spend a full day there (with food and drink), etc.

Of course, if you funded your own career, you’d also get a much higher per­cent­age of earn­ings, wouldn’t be locked into a lengthy con­tract, and wouldn’t suf­fer from the stigma of being a real­ity star win­ner. So you’d prob­a­bly even have a longer career than these win­ners, as plot­ted below (each bar rep­re­sents a dif­fer­ent win­ner from one of these real­ity shows). As a win­ner, you have a 55% chance of hav­ing a pop career of less than one year, and a 36% chance of less than six months.

My choice of home means I am implic­itly a mem­ber of numer­ous geopo­lit­i­cal groups, includ­ing those shown here.

“As an Amer­i­can cit­i­zen who still loves his native coun­try, France, it is heart­warm­ing to see that this coun­try appre­ci­ates the beauty and taste that all French­men prize.” Ray­mond Loewy (1893–1986)

What are the clas­sic designs that define Amer­ica? If you com­piled a list, it may include:

• The large Amer­i­can refrig­er­a­tor, as pop­u­larised by the sturdy, alu­minium shelved Sears Coldspot in the 1930s.
• Iconic Amer­i­can motor vehi­cles, includ­ing the sleek Grey­hound Bus, the influ­en­tial S-1 loco­mo­tive, or the “first Amer­i­can sports car”: the Stude­baker Star­liner Coupe.
• The slen­der­ized Coca-Cola bot­tle, or a coke soda fountain.
• The logos of large oil cor­po­ra­tions that power the coun­try, such as Shell, Exxon or BP.
• Some­thing pres­i­den­tial, such as the liv­ery of Air Force One.
• Some­thing from the space race, such as NASA’s Sky­lab space sta­tion.

If you haven’t guessed by now, Ray­mond Loewy had a hand in the design of all of the above. He was born in Paris in 1893, and is undoubt­edly one of the great­est indus­trial design­ers of all time.