The Association of the Dead

An old (but still current) news story from India never gained much attention outside of the country, but seems worth sharing.

For over thirty years, corruption and bribery have allowed people to declare others ‘dead’ – without formal evidence – thus allowing the claimant to take ownership of the deceased’s farming land. The newly ‘dead’ will usually know nothing of their passing until they have some formal interaction with a government service, where they will be told that they are dead and are therefore not entitled to the service.

One such victim, who was officially dead for 18 years, formed The Association of the Dead to raise awareness of the issue: “The Association seeks to reverse the declarations, call attention to the problem and prevent others from being exploited in similar fashion.”

When was the last time you had to check if you were dead?

DNA R/W+ 12 Speed

The speed at which Synthetic Biology is evolving (pun intended) is mind-blowing, especially to someone who has just stumbled upon the science (inspired by Tuur Van Balen’s presentation at Interesting 2009). In his words, it “will make most of us wonder why we ever got so excited about the Internet”.

You can tell a technology has exciting potential when ridiculous neologisms spread as quickly as the technology itself. In the 1990s the Internet had people “surfing” “cyberspace”; now synthetic biology has biopunks and wetware hackers.

Although much of the current literature is beyond my rudimentary understanding, the idea of BioBricks seems incredible. I would describe it as a “genetic programming language”, but that doesn’t do it justice. To paraphrase the description on the website:

Using BioBrick™ … parts, [you] can … program living organisms in the same way a computer scientist can program a computer. The DNA sequence information and other characteristics of BioBrick™ standard biological parts are made available to the public free of charge currently via MIT’s Registry of Standard Biological Parts.

In other words, there’s a growing free database of ‘biological parts’ (tastes, smells, reactions, proteins) that you can piece together to ‘re-program’ existing biological systems (typically bacteria); for example, here’s a part for a Banana odour generator:

tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagattaaagaggagaaatactagatgaatgaaatcgatga
gaaaaatcaggcccccgtgcaacaagaatgcctgaaagagatgattcagaatgggcatgctcggcgtatgggatctgttgaagatctgtatgttgctctc
aacagacaaaacttatatcgaaacttctgcacatatggagaattgagtgattactgtactagggatcagctcacattagctttgagggaaatctgcctga
aaaatccaactcttttacatattgttctaccaacaagatggccaaatcatgaaaattattatcgcagttccgaatactattcacggccacatccagtgca
tgattatatttcagtattacaagaattgaaactgagtggtgtggttctcaatgaacaacctgagtacagtgcagtaatgaagcaaatattagaagagttc
aaaaatagtaagggttcctatactgcaaaaatttttaaacttactaccactttgactattccttactttggaccaacaggaccgagttggcggctaattt
gtcttccagaagagcacacagaaaagtggaaaaaatttatctttgtatctaatcattgcatgtctgatggtcggtcttcgatccacttttttcatgattt
aagagacgaattaaataatattaaaactccaccaaaaaaattagattacattttcaagtacgaggaggattaccaattattgaggaaacttccagaaccg
atcgaaaaggtgatagactttagaccaccgtacttgtttattccgaagtcacttctttcgggtttcatctacaatcatttgagattttcttcaaaaggtg
tctgtatgagaatggatgatgtggaaaaaaccgatgatgttgtcaccgagatcatcaatatttcaccaacagaatttcaagcgattaaagcaaatattaa
atcaaatatccaaggtaagtgtactatcactccgtttttacatgtttgttggtttgtatctcttcataaatggggtaaatttttcaaaccattgaacttc
gaatggcttacggatatttttatccccgcagattgccgctcacaactaccagatgatgatgaaatgagacagatgtacagatatggcgctaacgttggat
ttattgacttcaccccctggataagcgaatctgacatgaatgataacaaagaaaatttttggccacttattgagcactaccatgaagtaatttcggaagc
tttaagaaataaaaagcatctccatggcttagggttcaatatacaaggcttcgttcaaaaatatgtgaacattgacaaggtaatgtgcgatcgtgccatc
gggaaaagacgcggaggtacattgttaagcaatgtaggtctgtttaatcagttagaggagcccgatgccaaatattctatatgcgatttggcatttggcc
aatttcaaggatcctggcaccaagcattttccttgggtgtttgttcgactaatgtaaaggggatgaatattgttgttgcttcaacaaagaatgttgttgg
tagtcaagaatctctcgaagagctttgctccatttacaaagctctccttttaggcccttaataatactagagccaggcatcaaataaaacgaaaggctca
gtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttat
a

At the moment, this isn’t quite available to the public; “re-programming” the bacteria currently requires a range of equipment, from the simple Petri dish to a centrifuge and incubator.

dna_writer

Even still, I’m excited by the prospect that this technology could become accessible to non-academics in the next ten years. In my crazed sci-fi mind, I picture an ‘off the shelf’ bacteria-pre-loaded ‘petri dish’ that you can ‘load into’ a component in your home PC; the CD-like device can then act as a centrifuge and anything else that’s required of it (the words of an ignorant dreamer!).

You can read more about BioBricks on Wikipedia, and numerous O’Reilly Radar posts (here, here, here and here) – all highly recommended reading.

petri-disc

Want to be a millionaire pop star? You’re better off buying £64 of lottery tickets than entering the X-Factor.

Let’s assume that if you had a few million pounds, you could probably buy yourself some hit songs from a songwriter, some studio and musician time, plenty of marketing, and almost certainly get yourself a pop career.

The question is; is it easier to get yourself into this position (a millionaire pop star) via pure luck (by entering the lottery) or by entering a competition like the X-Factor?

We don’t know how many people apply for the X-Factor, but based on 10,000 people at a single London audition, we could conservatively estimate 40,000.

Although the X-Factor markets itself on the winner receiving a “£1 million recording deal”, recent information about the contract has surfaced that shows “the victor may only receive £1 million after at least four albums” (note the ‘may’ and ‘at least’; we’ll ignore these for now and assume they will after four albums).

If we look at the number of albums released by winners of this type of show (X-Factor, Popstars, Pop Idol), we find that less than one in five winners (to date) have released four or more albums.

18% chance of releasing four albums

And we can’t even expect this to improve; plotting all the chart positions (for singles and albums) for all of these winners, over time, shows a distinct downward trend:

chart_positions

So, 1 in 40,000 application odds combined with 1 in 5.5 “four albums” odds gives total odds – of entering the X-Factor, winning and becoming a millionaire because of it – of about 1 in 220,000.

The chances of winning the lottery (with average jackpot winnings of £2,053,984) is 1 in 13,983,816. You would therefore need to buy £64 of tickets for a slightly better chance of winning the jackpot than becoming a millionaire through winning the X-Factor. £64 may seem like a lot, but probably doesn’t compare to the cost of travelling to/from the auditions, taking a day off work to spend a full day there (with food and drink), etc.

Of course, if you funded your own career, you’d also get a much higher percentage of earnings, wouldn’t be locked into a lengthy contract, and wouldn’t suffer from the stigma of being a reality star winner. So you’d probably even have a longer career than these winners, as plotted below (each bar represents a different winner from one of these reality shows). As a winner, you have a 55% chance of having a pop career of less than one year, and a 36% chance of less than six months.

career_lifespan

My GeoPolitical Memberships

The GeoPolitical Memberships of Dan ZamboniniMy choice of home means I am implicitly a member of numerous geopolitical groups, including those shown here.

Modern America: Designed by a Frenchman

“As an American citizen who still loves his native country, France, it is heartwarming to see that this country appreciates the beauty and taste that all Frenchmen prize.” Raymond Loewy (1893-1986)

What are the classic designs that define America? If you compiled a list, it may include:

If you haven’t guessed by now, Raymond Loewy had a hand in the design of all of the above. He was born in Paris in 1893, and is undoubtedly one of the greatest industrial designers of all time.