DNA R/W+ 12 Speed

The speed at which Synthetic Biology is evolving (pun intended) is mind-blowing, especially to someone who has just stumbled upon the science (inspired by Tuur Van Balen’s presentation at Interesting 2009). In his words, it “will make most of us wonder why we ever got so excited about the Internet”.

You can tell a technology has exciting potential when ridiculous neologisms spread as quickly as the technology itself. In the 1990s the Internet had people “surfing” “cyberspace”; now synthetic biology has biopunks and wetware hackers.

Although much of the current literature is beyond my rudimentary understanding, the idea of BioBricks seems incredible. I would describe it as a “genetic programming language”, but that doesn’t do it justice. To paraphrase the description on the website:

Using BioBrickâ„¢ … parts, [you] can … program living organisms in the same way a computer scientist can program a computer. The DNA sequence information and other characteristics of BioBrickâ„¢ standard biological parts are made available to the public free of charge currently via MIT’s Registry of Standard Biological Parts.

In other words, there’s a growing free database of ‘biological parts’ (tastes, smells, reactions, proteins) that you can piece together to ‘re-program’ existing biological systems (typically bacteria); for example, here’s a part for a Banana odour generator:

tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagattaaagaggagaaatactagatgaatgaaatcgatga
gaaaaatcaggcccccgtgcaacaagaatgcctgaaagagatgattcagaatgggcatgctcggcgtatgggatctgttgaagatctgtatgttgctctc
aacagacaaaacttatatcgaaacttctgcacatatggagaattgagtgattactgtactagggatcagctcacattagctttgagggaaatctgcctga
aaaatccaactcttttacatattgttctaccaacaagatggccaaatcatgaaaattattatcgcagttccgaatactattcacggccacatccagtgca
tgattatatttcagtattacaagaattgaaactgagtggtgtggttctcaatgaacaacctgagtacagtgcagtaatgaagcaaatattagaagagttc
aaaaatagtaagggttcctatactgcaaaaatttttaaacttactaccactttgactattccttactttggaccaacaggaccgagttggcggctaattt
gtcttccagaagagcacacagaaaagtggaaaaaatttatctttgtatctaatcattgcatgtctgatggtcggtcttcgatccacttttttcatgattt
aagagacgaattaaataatattaaaactccaccaaaaaaattagattacattttcaagtacgaggaggattaccaattattgaggaaacttccagaaccg
atcgaaaaggtgatagactttagaccaccgtacttgtttattccgaagtcacttctttcgggtttcatctacaatcatttgagattttcttcaaaaggtg
tctgtatgagaatggatgatgtggaaaaaaccgatgatgttgtcaccgagatcatcaatatttcaccaacagaatttcaagcgattaaagcaaatattaa
atcaaatatccaaggtaagtgtactatcactccgtttttacatgtttgttggtttgtatctcttcataaatggggtaaatttttcaaaccattgaacttc
gaatggcttacggatatttttatccccgcagattgccgctcacaactaccagatgatgatgaaatgagacagatgtacagatatggcgctaacgttggat
ttattgacttcaccccctggataagcgaatctgacatgaatgataacaaagaaaatttttggccacttattgagcactaccatgaagtaatttcggaagc
tttaagaaataaaaagcatctccatggcttagggttcaatatacaaggcttcgttcaaaaatatgtgaacattgacaaggtaatgtgcgatcgtgccatc
gggaaaagacgcggaggtacattgttaagcaatgtaggtctgtttaatcagttagaggagcccgatgccaaatattctatatgcgatttggcatttggcc
aatttcaaggatcctggcaccaagcattttccttgggtgtttgttcgactaatgtaaaggggatgaatattgttgttgcttcaacaaagaatgttgttgg
tagtcaagaatctctcgaagagctttgctccatttacaaagctctccttttaggcccttaataatactagagccaggcatcaaataaaacgaaaggctca
gtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttat
a

At the moment, this isn’t quite available to the public; “re-programming” the bacteria currently requires a range of equipment, from the simple Petri dish to a centrifuge and incubator.

dna_writer

Even still, I’m excited by the prospect that this technology could become accessible to non-academics in the next ten years. In my crazed sci-fi mind, I picture an ‘off the shelf’ bacteria-pre-loaded ‘petri dish’ that you can ‘load into’ a component in your home PC; the CD-like device can then act as a centrifuge and anything else that’s required of it (the words of an ignorant dreamer!).

You can read more about BioBricks on Wikipedia, and numerous O’Reilly Radar posts (here, here, here and here) – all highly recommended reading.

petri-disc

1 thought on “DNA R/W+ 12 Speed

  1. Pingback: Synthetic biology : clusterflock

Comments are closed.